I've spent years trying to tell the cis guys I know that simpsons and futurama quotes are a very poor way to flirt to no results
Remote
fwankie 
@Nerts@yiff.life
mastodon
4.7.0-alpha.2+glitch
Hi I'm Frankie
Follow me to see me yell about furry stuff and RPGs mostly
it/that/its ✨
0
Followers
809
Following
50
Posts
Joined August 16, 2018
Cohost (rip):
Bluesky (begrudgingly):
Discord:
fffwankie
Posts
dwarf jortress (it menaces with spikes of denim)
if H3VR was so good how come they didn't make a H4VR
Wrath and Glory time
I am using the marine as a distraction as he struggles to operate a touchscreen vending machine to simply shoplift things instead
fucked up that valve used AI and a time machine for Zoey's hands like that
thinking about that one meme that goes "Spongebob me boy, I've had me genome sequenced! ACTGACTGACTGACTGACTGACTGACTGACTG"
happy non-binary day, my pizza is 30 minutes late and counting
seeing an article about amazon investing in renewables and reducing carbon use
glancing out my window at one of their rusty ass diesel vans parked with the engine left running two doors down the street
Kids these days have to play video games to get a "Weird Route", back in my day we didn't have GPS so any time you went out of town w-[dragged off stage via crook]
Replying to
@Nerts@yiff.life
idk I like it when crowds awoo
skong awoo%
Replying to
@Nerts@yiff.life
hello my name is Hugh Mann and I enjoy phonecalls, TV, and instant coffee
you are a fucked up freak if you wake up and immediately get on a voice chat/phone call. why are you doing that to yourself
important things about Tachi from metal cardbot:
big kitty
60% legs
keeps bending forward to get low enough to talk to human characters
keeps doing crouched sprint starts
exposed ball joint hips
immense thighs
the pooltoy furries don't want you to realise this, but even the dummy thick ones weigh like 5kg of plastic max and you can just duct tape them to the wall if they're being rowdy
realising that a bunch of old cyberpunk stuff is having their titles become more hackery sounding once again because no one knows how a file directory works any more
Thinking about a pic I saw of a dog girl with big bappy paws wearing a shirt that said "I ♥️ femboys"
thinking about her kneeling over one of my femboy characters, sitting on the back of their head and forcing them face down into thick, chunky padded toes, to be specific
feeling like the Zap Branigan "Now here's a plan with some chest hair!" bit talking to someone else also GMing a Cyberpunk game because they're having their players fight 5 hired goons who have pistols and sporting equipment, and I'm putting mine up against several armoured vehicles
an important thing to keep in mind about how over the top a lot of warframe build theorycrafting is, is that they're ally seething about their build being worse than rumblejack w/random bullshit mods + melee influence + going 40 minutes deep on survival as Koumei
Replying to
@Nerts@yiff.life
taking me back to the good ol' days of hacks being about putting [h1]you'f been epically pwned[/h1] on people's screens and then bricking their system for kicks instead of deploying ransomware and hijacking crypto wallets
Replying to
@Nerts@yiff.life
ok we're up to 2, one drive works in my desktop but not this laptop for some reason so I had to swap SSDs around
anyway I think we should incinerate every laptop manufacturer
does anyone have that meme of a painting of two rollercoaster cars, one full of scared people and one full of zombies, labeled "people getting up at 6am" and "people still up at 6am"?
Replying to
@sirlan@derg.social
@sirlan I simply crop the notif bar off the top and let people imagine what I'm feeling the need to hide from them