Post #2202860
2024-08-08 06:40 UTC
@vladimir_lu@hachyderm.io @larsmb@mastodon.online I'm assuming you're ironic, but there is a point worth discussion. Mathematical models are intended to cover all general cases. Specifically in computer science we've been bitten by exactly the idea of "nobody will ever put this in" (see y2k bug). We've been through this. And on a more anthropological level good math (and physics) gets extended and remains valuable even in shifting contexts. LLMs are garbage in that way.
Replies (3)
-
@vladimir_lu@hachyderm.io 2024-08-08 16:19
@theuni@social.tchncs.de @larsmb@mastodon.online yeah mine was definitely sarcastic. You definitely hear a lot of “this couldn’t possibly ever happen” and then it does and you didn’t handle it in your code :)
-
@geospacedman@mastodon.social 2024-08-08 19:17
@theuni@social.tchncs.de @vladimir_lu@hachyderm.io @larsmb@mastodon.online It might get asked "How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?"
-
@ahltorp@mastodon.nu 2024-08-12 19:22
@theuni@social.tchncs.de @vladimir_lu@hachyderm.io @larsmb@mastodon.online The whole point of LLMs is to *not* do things “correctly”. The LLM is doing it’s job perfectly here, it’s just that the expectation is wrong.