Elektrine lite

← Feed

@geospacedman@mastodon.social

Post #2202862

2024-08-08 19:17 UTC

@theuni@social.tchncs.de @vladimir_lu@hachyderm.io @larsmb@mastodon.online It might get asked "How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?"

Replies (3)

  • @theuni@social.tchncs.de 2024-08-08 19:26

    @geospacedman@mastodon.social @vladimir_lu@hachyderm.io @larsmb@mastodon.online There are no C in DNA sequences. This is an often made confusion as there are only G, T and A in DNA as the C looks much alike the G.

    Open ##2202863

  • @dascandy@infosec.exchange 2024-08-09 06:07

    @geospacedman@mastodon.social @theuni@social.tchncs.de @vladimir_lu@hachyderm.io @larsmb@mastodon.online statistically you are over 99% likely to have GATTACA in your DNA.

    Open ##2202869

  • @SharkAttak@masto.ai 2024-08-13 21:43

    @geospacedman@mastodon.social @theuni@social.tchncs.de @vladimir_lu@hachyderm.io @larsmb@mastodon.online This sounds like the premise of a bad sci-fi horror movie..

    Open ##2202870